SuperTutor

(15)

$15/per page/Negotiable

About SuperTutor

Levels Tought:
Elementary,Middle School,High School,College,University,PHD

Expertise:
Accounting,Business & Finance See all
Accounting,Business & Finance,Economics,Engineering,HR Management,Math Hide all
Teaching Since: Apr 2017
Last Sign in: 360 Weeks Ago, 1 Day Ago
Questions Answered: 12843
Tutorials Posted: 12834

Education

  • MBA, Ph.D in Management
    Harvard university
    Feb-1997 - Aug-2003

Experience

  • Professor
    Strayer University
    Jan-2007 - Present

Category > Biology Posted 26 Apr 2017 My Price 15.00

Assignment 3

Assignment 3 This assignment is marked out of 100 possible points and is worth 15 % of your final grade. It is
based on Units 9–13. Complete it after Unit 13. Submit it to your academic expert for grading
using the appropriate Assignment Drop Box.
Unless otherwise directed, the information you need to answer these questions is available
from the course materials. Further research is not required. Some questions may require
information from more than one unit or lesson.
Answer the questions in your own words, using full sentences unless directed to do otherwise.
For each of questions 1–5, select and support the most appropriate response, and explain why
each of the incorrect statements is eliminated.
1. DNA
a.
b.
c.
d.
e. is always interpreted using the same code, with minor exceptions.
incorporates any type of the five nitrogenous bases.
bases occur in random order.
joins bases to each other covalently.
is not the genetic material in bacteria. (5 marks) 2. Which of these factors does not influence the rate of mutation?
a.
b.
c.
d.
e. the presence of a repetitive sequence
the protein encoded by the gene
the presence of a palindrome
a gene’s length
the ability to repair DNA (5 marks) 3. Eugenics
a.
b.
c.
d.
e. depends on voluntary participation.
is successful at eliminating harmful recessive alleles from a population.
is a form of natural selection.
is intended to alleviate individual suffering.
may involve sterilization. (5 marks) 4. Analysis of which source of data does not contribute to tracing human and/or ancestral
human migration patterns?
a.
b.
c.
d.
e. fossils
mitochondrial DNA
admixture info
chromosome banding
haplogroups Biology 341: Human Genetics (Rev. C14) (5 marks) 1 5. Compare the contributions of Levene and Chargaff in the determination of the structure of
DNA. Why wasn’t their information enough to determine the correct structure?
(4 marks)
6. Repeat the exercise described in Unit 9 Lesson 3 Study Question 2 for a third replication (do
not submit this drawing). How many double helices will contain only higher-density
nitrogen? How many double helices will have intermediate density? How many double
helices will contain only lighter-density nitrogen?
(3 marks)
7. Compare cellular DNA replication to PCR replication. (6 marks) 8. The following sequence is a DNA coding strand representing a portion of a gene.
(9 marks)
5’…ATGCGTTCAGCTACTTTAGAGCGAATCC… 3’
a. Give the sequence that will be produced in replication.
b. What sequence will be produced as a result of transcription?
c. Translate the sequence in part b, using three reading frames. Do not translate the
partial codons.
d. What feature of the genetic code is revealed by these sequences? Identify a specific
example.
9. There are 49 nuclear genes that code for tRNA molecules. There are 61 codons for amino
acids. The 49 different tRNA molecules can translate all 61 amino acid codons. Answer the
following theoretical questions, and explain your answers. Include the names of the amino
acids for the codons noted.
(6 marks)
a. Could a single type of tRNA molecule be used in the translation of CAC and CAG?
b. Could a single type of tRNA molecule be used to translate AUU and AUA?
c. Could a single type of tRNA molecule be used to translate UCU and AGC?
10. Do these descriptions support or refute the statement that a region of DNA can code for
more than one polypeptide? Explain.
(6 marks)
a. Exons can be joined in different combinations.
b. An intron can become an exon.
c. Both strands of the DNA can be used as different genes.
11. Compare and contrast genetic heterogeneity and allelic disorders. (4 marks) 12. Describe the possible effects of each of these mutations on a gene’s protein. Which of these
mutations in a gene would likely have the most severe effect on its protein? Explain.
a.
b.
c.
d.
e. missense
point mutation in an intron
a deletion of three bases
a translocation
a nonsense mutation at the end of the gene Biology 341: Human Genetics (Rev. C14) (12 marks) 2 13. A population of 5545 people is assumed to be in Hardy-Weinberg equilibrium. Of this
population, 3607 have the dominant trait of lactase persistence. The recessive form of this
trait is lactose intolerance. Showing all calculations, determine
(10 marks)
a.
b.
c.
d.
e. the frequency of the homozygous recessive genotype in the population.
the frequency of the recessive allele.
the frequency of the dominant allele.
the number of homozygous dominant people.
the number of heterozygous people. 14. A rural population in Quebec has a significantly higher level of phenylketonuria compared to
the urban population of Montreal. There are multiple explanations for this phenomenon.
Propose four hypotheses, and specifically describe how they could explain the difference
between the rural and urban populations. What type of information or research would be
used to determine which explanation/s is/are most likely?
(10 marks)
15. Choose any two species from the list of Key Terms in Unit 13 Lesson 1. Create a table or
other format to compare their times of existence, geographic ranges, physical features,
habitats, and socio-cultural features.
(6 marks) Biology 341: Human Genetics (Rev. C14) 3

 

Answers

(15)
Status NEW Posted 26 Apr 2017 05:04 AM My Price 15.00

-----------

Attachments

file 1493187356-Solutions file.docx preview (56 words )
S-----------olu-----------tio-----------ns -----------fil-----------e -----------Hel-----------lo -----------Sir-----------/Ma-----------dam----------- T-----------han-----------k y-----------ou -----------for----------- yo-----------ur -----------int-----------ere-----------st -----------and----------- bu-----------yin-----------g m-----------y p-----------ost-----------ed -----------sol-----------uti-----------on.----------- Pl-----------eas-----------e p-----------ing----------- me----------- on----------- ch-----------at -----------I a-----------m o-----------nli-----------ne -----------or -----------inb-----------ox -----------me -----------a m-----------ess-----------age----------- I -----------wil-----------l b-----------e q-----------uic-----------kly----------- on-----------lin-----------e a-----------nd -----------giv-----------e y-----------ou -----------exa-----------ct -----------fil-----------e a-----------nd -----------the----------- sa-----------me -----------fil-----------e i-----------s a-----------lso----------- se-----------nt -----------to -----------you-----------r e-----------mai-----------l t-----------hat----------- is----------- re-----------gis-----------ter-----------ed -----------onÂ----------- th-----------is -----------web-----------sit-----------e. ----------- H-----------YPE-----------RLI-----------NK -----------&qu-----------ot;-----------htt-----------p:/-----------/wo-----------rkb-----------ank-----------247-----------.co-----------m/&-----------quo-----------t; -----------\t -----------&qu-----------ot;-----------_bl-----------ank-----------&qu-----------ot;----------- -----------Tha-----------nk -----------you----------- -----------
Not Rated(0)