The world’s Largest Sharp Brain Virtual Experts Marketplace Just a click Away
Levels Tought:
Elementary,Middle School,High School,College,University,PHD
| Teaching Since: | Apr 2017 |
| Last Sign in: | 327 Weeks Ago, 4 Days Ago |
| Questions Answered: | 12843 |
| Tutorials Posted: | 12834 |
MBA, Ph.D in Management
Harvard university
Feb-1997 - Aug-2003
Professor
Strayer University
Jan-2007 - Present
Given the sequence of DNA
5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’
a. What would happen if the third “G” from the original strand is replaced with a “C”? Explain. (3)
b. What would happen if the third “C” is removed from the sequence? Explain. (3)
-----------