Maurice Tutor

(5)

$15/per page/Negotiable

About Maurice Tutor

Levels Tought:
Elementary,Middle School,High School,College,University,PHD

Expertise:
Algebra,Applied Sciences See all
Algebra,Applied Sciences,Biology,Calculus,Chemistry,Economics,English,Essay writing,Geography,Geology,Health & Medical,Physics,Science Hide all
Teaching Since: May 2017
Last Sign in: 398 Weeks Ago, 5 Days Ago
Questions Answered: 66690
Tutorials Posted: 66688

Education

  • MCS,PHD
    Argosy University/ Phoniex University/
    Nov-2005 - Oct-2011

Experience

  • Professor
    Phoniex University
    Oct-2001 - Nov-2016

Category > Computer Science Posted 17 Sep 2017 My Price 3.00

genes in DNA sequences

Consider the problem of searching for genes in DNA sequences using Horspool’s algorithm. A DNA sequence is represented by a text on the alphabet {A, C, G, T}, and the gene or gene segment is the pattern.

a. Construct the shift table for the following gene segment of your chromosome

10:

TCCTATTCTT

b. Apply Horspool’s algorithm to locate the above pattern in the following DNA sequence:

TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT

Answers

Maurice Tutor
(5)
Status NEW Posted 17 Sep 2017 02:09 PM My Price 3.00

Hel-----------lo -----------Sir-----------/Ma-----------dam-----------Tha-----------nk -----------You----------- fo-----------r u-----------sin-----------g o-----------ur -----------web-----------sit-----------e a-----------nd -----------and----------- ac-----------qui-----------sit-----------ion----------- of----------- my----------- po-----------ste-----------d s-----------olu-----------tio-----------n.P-----------lea-----------se -----------pin-----------g m-----------e o-----------n c-----------hat----------- I -----------am -----------onl-----------ine----------- or----------- in-----------box----------- me----------- a -----------mes-----------sag-----------e I----------- wi-----------ll

Not Rated(0)