The world’s Largest Sharp Brain Virtual Experts Marketplace Just a click Away
Levels Tought:
Elementary,Middle School,High School,College,University,PHD
| Teaching Since: | May 2017 |
| Last Sign in: | 406 Weeks Ago, 2 Days Ago |
| Questions Answered: | 66690 |
| Tutorials Posted: | 66688 |
MCS,PHD
Argosy University/ Phoniex University/
Nov-2005 - Oct-2011
Professor
Phoniex University
Oct-2001 - Nov-2016
Consider the problem of searching for genes in DNA sequences using Horspool’s algorithm. A DNA sequence is represented by a text on the alphabet {A, C, G, T}, and the gene or gene segment is the pattern.
a. Construct the shift table for the following gene segment of your chromosome
10:
TCCTATTCTT
b. Apply Horspool’s algorithm to locate the above pattern in the following DNA sequence:
TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT
Hel-----------lo -----------Sir-----------/Ma-----------dam-----------Tha-----------nk -----------You----------- fo-----------r u-----------sin-----------g o-----------ur -----------web-----------sit-----------e a-----------nd -----------and----------- ac-----------qui-----------sit-----------ion----------- of----------- my----------- po-----------ste-----------d s-----------olu-----------tio-----------n.P-----------lea-----------se -----------pin-----------g m-----------e o-----------n c-----------hat----------- I -----------am -----------onl-----------ine----------- or----------- in-----------box----------- me----------- a -----------mes-----------sag-----------e I----------- wi-----------ll