The world’s Largest Sharp Brain Virtual Experts Marketplace Just a click Away
Levels Tought:
Elementary,Middle School,High School,College,University,PHD
| Teaching Since: | Apr 2017 |
| Last Sign in: | 360 Weeks Ago, 2 Days Ago |
| Questions Answered: | 12843 |
| Tutorials Posted: | 12834 |
MBA, Ph.D in Management
Harvard university
Feb-1997 - Aug-2003
Professor
Strayer University
Jan-2007 - Present
Ann Hematol (1999) 78 : 157–162 Q Springer-Verlag 1999 ORIGINAL ARTICLE
S. Viehmann 7 A. Borkhardt 7 F. Lampert
J. Harbott Multiplex PCR – a rapid screening method for detection of gene
rearrangements in childhood acute lymphoblastic leukemia Received: July 27, 1998 / Accepted: January 21, 1999 Abstract Chromosomal rearrangements in childhood
acute lymphoblastic leukemia (ALL) play an important
role in the identification of clinical relevant subgroups.
For rapid and easy detection of the clinically most important gene rearrangements, a nested multiplex reverse transcriptase polymerase chain reaction (multiplex PCR) was developed. This multiplex PCR enables
the detection of M-BCR/ABL, m-BCR/ABL, TEL/
AML1, and MLL/AF4 fusion transcripts in one PCR
reaction. However, the existence of splicing variants
and different breakpoints on the DNA level hampers
the discrimination of the rearrangements by their fragment size on an agarose gel. Therefore, one of the internal primers of each translocation (ABL-2, TEL-2,
AF4–2) was labeled with a characteristic fluorescent
dye, and an automatic fluorescence-based DNA fragment analysis was performed. The sensitivity of this
multiplex PCR is in the same range as that of the corresponding single PCR reaction and allows a fast screening for the detection of therapy-relevant rearrangements, with a high turnover of samples.
Keywords Multiplex PCR 7 Chromosomal
rearrangements 7 ALL 7 Genescan analysis Introduction
Acute lymphoblastic leukemia (ALL), the most common childhood malignancy, is associated with chromos- The study was granted in parts by the Deutsche Krebshilfe,
the Parents’ Leukemia Research Fund Gießen,
the Forschungshilfe Station Peiper, and the Deutsche Leukämie
Forschungshilfe (DLFH).
S. Viehmann 7 A. Borkhardt 7 F. Lampert 7 J. Harbott (Y)
Oncogenetic Laboratory, Children’s Hospital, University of
Gießen, Feulgenstrasse 12, D-35385 Gießen, Germany
e-mail: Jochen.Harbott6paediat.med.uni-giessen.de,
Tel.: 0049-641-99-43426, Fax: 0049-641-99-43485 omal translocations allowing the identification of prognostically relevant subgroups [17, 26, 29]. These translocations or their molecular equivalents – t(9;22) (BCR/
ABL), t(4;11) (MLL/AF4), and t(1;19) (PBX1/EA2) –
are used to identify high-risk patients in most large
therapy trials [8, 9, 13, 30, 31, 32, 37, 38, 39]. In the German multicenter trials ALL-BFM-95 and CoALL, genetic analysis is centralized and all bone marrow and/or
blood samples of children with ALL are routinely
screened for these rearrangements by PCR, with the
exception of PBX1/EA2. In addition, all samples are
screened for TEL/AML1 [t(12;21)] the most frequent
fusion gene (25%) of childhood B-cell precursor ALL,
which is supposed to have a good prognosis [3, 18, 25,
27, 36, 40, 41]. At present, the PCR of these rearrangements is performed in separate PCR assays, which is
not only time and material consuming but also very expensive.
Based on these considerations, we developed a multiplex PCR that allows detection of the rearrangements
BCR/ABL minor breakpoint (m), BCR/ABL major
breakpoint (M), TEL/AML1, and MLL/AF4 in one
step. A primer mix containing seven primers (M-BCR,
m-BCR, ABL, TEL, AML1, MLL, AF4) was used for
the multiplex PCR, in order to detect all four rearrangements in one assay. To improve sensitivity and specificity, a nested PCR protocol was performed.
Different breakpoints and/or splicing variants are
described for BCR/ABL, TEL/AML1, and MLL/AF4
[1, 2, 4, 6, 7, 14, 15, 16, 20, 21, 24, 28, 35, 45] and, consequently, a broad range of different PCR products
could originate in the multiplex PCR. The difference of
a few basepairs will therefore complicate the determination of the rearrangements by fragment size on an
agarose gel. Genescan analysis overcomes this problem
by labeling one internal primer of each rearrangement
on the 5b-end with a characteristic fluorescent dye
(Fig. 1). Using this technique, the rearrangements can
be identified not only by their fragment size, but also
by their characteristic fluorescence emission. 158
analyzed by multiplex PCR retrospectively. For positive controls
and sensitivity assays, cell lines (K562, SD1, MV4-11, RS4-11,
REH, HL60) with the corresponding translocations were used
[11, 12, 42, 44]. Mononuclear cells of patients were isolated by
centrifugation using Nycoprep 1.077 (Nycomed, Oslo, Norway)
and stored at –70 7C prior to use. Cell lines grown in suspension
culture were centrifuged and stored at –70 7C.
For sensitivity studies 1 million cells of cell lines carrying one
of the rearrangements (K562/M-BCR; SD1/m-BCR; REH/TEL/
AML1; MV4-11/MLL/AF4) were serially diluted 1 : 10 with HL60
cells lacking any of these translocations. Reverse transcriptase-polymerase chain reaction (RT-PCR)
assay Fig. 1 The second round of multiplex PCR. One internal primer
of each rearrangement is labeled with a characteristic fluorescence dye on the 5b-end: TEL-2 with FAM (G blue), AF4-2 with
TAMRA (B yellow), and ABL with JOE (} green) Patients and methods
Patients and cell lines
Bone marrow or peripheral blood samples of patients with ALL
were sent by mail from more than 70 pediatric oncology centers
in Germany. The BCR/ABL major breakpoint was tested mainly
with samples of CML patients. Ninety patients with ALL and
four with CML consecutively enrolled in ongoing studies in Germany (ALL-BFM; CoALL, CML-päd) were screened by single
PCR assays and multiplex PCR in parallel. Additionally, 60 patients (54 ALL and six CML) with a known rearrangement were Table 1 PCR primers used in
the multiplex assay.
fdpfluorescent dye;
JOEpgreen; FAMpblue;
TAMRApyellow Total RNA was extracted in a single-step method [5] and dissolved in 15 ml dH2O. Three micrograms of cell-line RNA or 7 ml
of patient RNA (about 1–5 mg) were reverse-transcribed with
200 units of SuperScript TM RNase H – reverse transcriptase (GibcoBRL, Eggenstein, Germany). Following denaturation at 70 7C
for 10 min, the cDNA synthesis was carried out at 37 7C for
45 min using random hexamer primers in a total volume of 20 ml.
Subsequently, the cDNA was heated to 95 7C for 5 min to inactivate the reverse transcriptase and was then stored at –20 7C.
Maximum sensitivity and specificity were achieved by using a
nested-PCR protocol. To verify the integrity of the isolated RNA
and the correctness of the cDNA synthesis, the ubiquitously expressed ABL gene was amplified in a separate PCR. Primer sequences for the multiplex PCR assay and the amplification of
ABL are given in Tables 1 and 2. The first round of PCR was
done with the external primers. In the second round the internal
primers ABL-2, TEL-2, and AF4-2 marked with a characteristic
fluorescent dye at their 5b-end were used (Table 1). Amplification was performed with a Perkin Elmer Thermocycler 9600 (Perkin Elmer, Weiterstadt, Germany).
In the first round of PCR, 1 ml of cDNA was used for the
ABL control assay, 1 ml for sensitivity assays, and 3 ml for the
multiplex assay. The PCR was carried out in a final volume of
20 ml with 1!PCR-Buffer (GibcoBRL, Eggenstein, Germany),
1.5 mM MgCl2, 0.2 mM of each dNTP (Boehringer Mannheim,
Germany), 4% DMSO (only for the multiplex assay), 1.6 pmol of
each primer, and 1 unit Taq polymerase (GibcoBRL, Eggenstein,
Germany).
After an initial melting step (90 s at 95 7C), 35 amplification
cycles of 15 s at 94 7C, 45 s at 64 7C, and 45 s at 72 7C were performed, followed by an extension step (6 min at 72 7C). One microliter of the first-round PCR product was subjected to the second round of PCR, differing by the annealing temperature
(60 7C), the primer concentration (8 pmol), and the number of cy- Multiplex PCR primer
Primer
Position, orientation
BCR-M-1 External, sense
BCR-M-2 Internal, sense
BCR-m-1 External, sense Sequence 5b-NNN-3
CCTCTGACTATGAGCGTGCAGAGT
AGAAGTGTTTCAGAAGCTTCTCCCT
CAGCTCCAATGAGAACCTCACCTCCAGCG fd
P
P
P BCR-m-2
ABL-1
ABL-2
TEL-1
TEL-2
AML1–1
AML1–2
MLL-1
MLL-2
AF4–1
AF4–2 AACTCGCAACAGTCCTTCGACAGCAGCAG
CTCAGCGGATACTCAGCGGCATTGCGG
ACTGTTGACTGGCGTGATGTAGTTGCTTGG
ACCAGGAGTCCTACCCTCTGTCAGTG
CCGGCAGGAGAGCACACGCGTGATCCAG
GTAGGCAGCACGGAGCAGAGGAAGTTGG
AACGCCTCGCTCATCTTGCCTGGGCTCAG
CTGAATCCAAACAGGCCACCACTC
GGTCTCCCAGCCAGCACTGGTC
CTCACTGTCACTGAGCTGAAGGTCGTCTTCG
AGCATGGATGACGTTCCTTGCTGAG P
P
JOE
P
FAM
P
P
P
P
P
TAMRA Internal, sense
External, antisense
Internal, antisense
External, sense
Internal, sense
External, antisense
Internal, antisense
External, sense
Internal, sense
External, antisense
Internal, antisense 159
Table 2 PCR Primers used in
the ABL control assay.
fdpfluorescent dye ABL control PCR primer
Primer
Position, orientation
ABL-K1a
External, sense
ABL-K1b
External, antisense
ABL-K2a
Internal, sense
ABL-K2b
Internal, antisense cles (25). Ten microliters of the final PCR products were analyzed
on a 1% agarose gel and visualized by ethidium bromide staining.
Genescan analysis
All amplification products which could not be exactly assigned to
a rearrangement by fragment size were subsequently characterized by Genescan analysis. Depending on the concentration, the
final PCR product was used undiluted or diluted with sterile water 1 : 10 or 1 : 30.
One microliter of the undiluted or diluted PCR product was
mixed with 0.5 ml Genescan standard (Genescan-2500 TMROX;
Perkin Elmer, Weiterstadt) and 2.5 ml formamide. The samples
were denatured at 90 7C for 2 min, subsequently chilled on ice,
and subjected to electrophoresis using a 5% polyacrylamide gel in
an automatic DNA-sequencer 373 A (Perkin Elmer, Weiterstadt). Gels were analyzed using an Apple Macintosh IIci computer and the Genescan software as supplied by the manufacturer. Sequence 5b-NNN-3
CCAGTAGCATCTGACTTTGAGCCT
CCAGACTGTTGACTGGCGTGATGT
TGAGTGAAGCCGCTCGTTGGAACT
TTCACACCATTCCCCATTGTGATT fd
P
P
P
P however, showed no amplification in the multiplex assay but were positive for TEL/AML1 in the single
PCR.
Ninety-four patients (90 ALL and four CML) were
analyzed prospectively over a period of 2 months with
single PCR reactions and multiplex PCR in parallel,
and a complete concordance was found in 90 of them.
In 67 patients none of the analyzed rearrangements was
detected, whereas four showed M-BCR/ABL, five mBCR/ABL, 13 TEL/AML1, and one the MLL/AF4
rearrangement. In the remaining four cases a TEL/
AML1 amplification was visible in the single PCR assay, but no PCR product was observed by multiplex
PCR.
The 12 TEL/AML1-negative patients of both the
prospective and the retrospective study were additionally analyzed by the more sensitive Genescan technique. Ten of them showed a weak blue signal, two
whereas remained negative. Results
The multiplex PCR assay was able to detect all four
rearrangements and their characteristic splicing variants or molecular breakpoints in the cell lines K562
(M-BCR/ABL), SD1 (m-BCR/ABL), REH (TEL/
AML1), and MV4-11 (MLL/AF4) and in the patient
samples (Figs. 2 and 3).
The sensitivity assays detected one cell harboring
the rearrangement in the following dilutions: M-BCR/
ABL (K562) 10 –4, m-BCR/ABL (SD1) 10 –3, TEL/
AML1 (REH) 10 –3, MLL/AF4 (MV4–11) 10 –4 (Fig. 4).
Whereas the sensitivity for MLL/AF4 (10 –4) and mBCR/ABL (10 –3) was of the same order of magnitude
as the corresponding single PCR reaction, it was ten
times lower for M-BCR/ABL (10 –4) and TEL/AML1
(10 –3).
PCR products of cell lines could be discriminated by
their fragment size on an agarose gel (Fig. 2) and, additionally, they were analyzed by the Genescan method.
With this technique, the PCR product of BCR/ABL
showed a green signal with a fragment size of 447 bp
(e1/a2) for SD1 and 470 bp (b3/a2) for K562. The REH
cell line was detected by a blue double band of 306 and
345 bp, corresponding to the two variants of TEL/
AML1 (e5/e2 and e5/e3), and for the MV4-11 cell line
one yellow amplification product of 381 bp (e6/c) became visible (Fig. 3).
Of the 60 patients (54 ALL and six CML) analyzed
retrospectively by multiplex PCR the results were concordant in 52 cases (seven M-BCR/ABL, five m-BCR/
ABL, 36 TEL/AML1, four MLL/AF4). Eight of them, Discussion
Identification of specific chromosomal aberrations or
their molecular equivalents is an important tool for diagnosis and therapy stratification in childhood ALL
[17, 26, 29]. Conventional cytogenetics allow the detec- Fig. 2 Agarose gel analysis of different PCR products from patients and cell lines. Lane M: 123-bp marker; lanes 1, 2, 7, 10: patients with no rearrangement; lanes 3, 5, 9: patients with TEL/
AML1 (e5/e2) rearrangement; lane 6: patient with TEL/AML1
(e5/e3) rearrangement; lanes 4, 8: patients with m-BCR/ABL (el/
a2) rearrangement. Lanes 11–14, cell lines used as positive controls – lane 11: K562 (M-BCR/ABL), lane 12: SD1 (m-BCR/
ABL), lane 13: REH (TEL/AML1); lane 14: MV4–11 (MLL/
AF4) 160
Fig. 3 Genescan analysis of
different PCR products from
patients and cell lines. BCR/
ABL PCR products are labeled in green, TEL/AML1 in
blue, MLL/AF4 in yellow, and
the internal size marker in
red. Lanes 1, 2: cell line RS411 (MLL/AF4) diluted 1 : 30
and 1 : 10, respectively; lane 3:
patient with MLL/AF4 rearrangement; lanes 4, 13, 15: patients with two splicing variants of the TEL/AML1 (the
small variant in lane 15 detected only by computer);
lanes 5, 8, 11: patients with the
small variant of TEL/AML1;
lanes 6, 7, 14: patients with mBCR/ABL gene fusion; lanes
9, 10, 12: patients with b2a2
M-BCR/ABL rearrangement.
Lanes 16–19, cell lines – lane
16: K562 (M-BCR/ABL); lane
17: SD1 (m-BCR/ABL); lane
18: REH (TEL/AML1); lane
19: MV4-11 (MLL/AF4) tion of all these aberrations. However, it is very time
consuming, the sensitivity is low, and, especially after
mailing, the success rate is relatively low [19, 23]. In addition, cryptic translocations such as t(12;21) are hardly
detectable [31, 34]. PCR techniques allow the identification of all clinically relevant aberrations in a fast and
sensitive way. For screening, however, several PCR
reactions have to be performed in order to detect one
of these aberrations in a single patient. This time-consuming and expensive work could be overcome by a
multiplex PCR that allowed the detection of all important rearrangements in one assay. Different multiplex
PCRs have been reported for leukemias [10, 22, 33, 43],
but none of them is able to detect the four rearrangements M-BCR/ABL, m-BCR/ABL, MLL/AF4, and
TEL/AML1 in one assay.
Splicing variants and/or different breakpoints are
known for these rearrangements. In the majority of patients two types of BCR/ABL exist. The major breakpoint (M-BCR) is found mainly in CML, whereas the
minor breakpoint (m-BCR) can be detected in ALL
patients [6, 20, 24]. The break of the ABL gene occurs
mostly between exon a1 and a2 (rarely between a2 and
a3), and in the BCR gene it is located behind exon e1 (m-BCR) or behind exon e13/b2 as well as e14/b3 (MBCR) [4]. For TEL/AML1, two main forms are described, resulting in a fusion of TEL exon e5 and
AML1 exon e2 or e3 [1, 14, 28, 35, 45]. The MLL/AF4
rearrangement shows the largest heterogeneity. In the
MLL gene the breaks occur in an 8.3-kb breakpoint region, mainly after exons e6, e7, and e8. For AF4 three
different breakpoints are described (b, c, d), and in addition alternative splicing is reported in MLL/AF4 [3, 7,
15, 16, 21].
Because of this molecular heterogeneity, agarose gel
analysis might be not sufficient in some cases to identify the specific rearrangement exactly. However, Fluorescent labeling of the internal primer overcomes this
problem. With Genescan analysis the existing rearrangement can be determined by its characteristic fluorescence color and fragment size. Furthermore, the
Genescan analysis allows the exact size calculation of
each PCR product by application of an internal ROXlabeled standard. Therefore, it is possible to determine
the splicing variants or breakpoints of the rearrangements.
A complete concordance was observed for the rearrangements M-BCR/ABL, m-BCR/ABL, and MLL/ 161 which is more sensitive than a normal agarose gel. In
consequence, all samples should be analyzed with the
Genescan technique, and other PCR methods, e.g., hot
start PCR, should be be tested in parallel to optimize
the assay. Nevertheless, the multiplex PCR is a powerful tool for detecting the therapy-relevant rearrangements in a short time with a high sample turnover.
Acknowledgments For their excellent technical assistance we are
indebted to Christina Böth, Gabriele Jürges, Claudia Keller, and
Andrea Richter. We are grateful to our colleagues from all pediatric oncology centers who supplied us with samples from their
patients. References Fig. 4 Sensitivity assays for the rearrangements M-BCR/ABL, mBCR/ABL, TEL/AML1, and MLL/AF4 with the corresponding
cell lines. Lane M: 123-bp marker; lane 1: undiluted; lane 2: diluted 10 P1; lane 3: diluted 10 P2; lane 4: diluted 10 P3; lane 5: diluted 10 P4; lane 6: diluted 10 P5; lane 7: cell line HL60 undiluted;
lane 8: negative control AF4. All patients positive for one of these rearrangements by single PCR are positive in the multiplex assay
as well. For the TEL/AML1 rearrangement, however, a
discrepancy became obvious. Of 61 patients with a
TEL/AML1 rearrangement in routine single PCR assay, 12 (19.7%) showed no amplification in the multiplex PCR. This could be due to the sensitivity, which is
ten times lower (10 –3) in the multiplex PCR. The sensitivity of m-BCR/ABL is in the same range as that of
TEL/AML1, but no difference to the single PCR reaction is noticeable. It is possible that expression of the
TEL/AML1 fusion transcript in patients is lower than
that of m-BCR/ABL, whereas in the two cell lines
REH (TEL/AML1) and SD1 (m-BCR/ABL) the same
expression rate exists.
On the other hand, patients’ bone marrow or blood
samples sent to our laboratory by mail are 24–48 h old,
whereas the RNA samples from cell lines were prepared directly. Cells harboring the TEL/AML1 rearrangement might be more sensitive, and in consequence the amount of RNA could be lower. Possibly,
the sensitivity of 10 –3 achieved by this multiplex assay is
too low, whereas the detection level of the single PCR
(10 –4) is sufficient.
Furthermore, PCR inhibitors of blood and bone
marrow samples (e.g., heparin, hemoglobin) could be
carried and therefore influence the PCR effectiveness
of patient samples, especially in the case of TEL/
AML1.
Ten of the 12 TEL/AML1 false-negative cases
showed a weak blue signal in the Genescan analysis, 1. Baens M, Peeters P, Guo CY, Aerssens J, Marynen P (1996)
Genomic organization of TEL: the human ETS-variant gene
6. Genome Res 6 : 404–413
2. Borkhardt A, Repp R, Haupt E, Brettreich S, Buchen U,
Gossen R, Lampert F (1994) Molecular analysis of MLL-1/
AF4 recombination in infant acute lymphoblastic leukemia.
Leukemia 8 : 549–553
3. Borkhardt A, Cazzaniga G, Viehmann S, Valsecchi MG, Ludwig WD, Burci L, Mangioni S, Schrappe M, Riehm H, Lampert F, Basso G, Masera G, Harbott J, Biondi A (1997) Incidence and clinical relevance of TEL/AML1 fusion genes in
children with acute lymphoblastic leukemia enrolled in the
German and Italian multicenter therapy trials. Blood
90 : 571–577
4. Chissoe SL, Bodenteich A, Wang YF, Wang YP, Burian D,
Clifton SW, Crabtree J, Freeman A, Iyer K, Jian L, Ma Y,
McLaury HJ, Pan HQ, Sarhan OH, Toth S, Wang Z, Zhang
G, Heisterkamp N, Groffen J, Roe BA (1995) Sequence and
analysis of the human ABL gene, the BCR gene, and regions
involved in the Philadelphia chromosomal translocation. Genomics 27 : 67–82
5. Chomczynski P, Sacchi N (1987) Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem 162 : 156–159
6. Clark SS, McLaughlin J, Crist WM, Champlin R, Witte ON
(1987) Unique forms of the abl tyrosine kinase distinguish
Ph1-positive CML from Ph1-positive ALL. Science
235 : 85–88
7. Corral J, Forster A, Thompson S, Lampert F, Kaneko Y,
Slater R, Kroes WG, van der Schoot CE, Ludwig WD, Karpas A, Pocock C, Cotter F, Rabbitts TH (1993) Acute leukemias of different lineages have similar MLL gene fusions
encoding related chimeric proteins resulting from chromosomal translocation. Proc Natl Acad Sci U S A 90 : 8538–8542
8. Crist W, Carroll A, Shuster J, Jackson J, Head D, Borowitz
M, Behm F, Link M, Steuber P, Ragab A, Hirt A, Brock B,
Land VJ, Pullen DJ (1990) Philadelphia chromosome-positive childhood acute lymphoblastic leukemia: clinical and cytogenetic characteristics and treatment outcome. A Pediatric
Oncology Group study. Blood 76 : 489–494
9. Crist WM, Carroll AJ, Shuster JJ, Behm FG, Whitehead M,
Vietti TJ, Look AT, Mahoney D, Ragab A, Pullen DJ, Land
VJ (1990) Poor prognosis of children with pre-B acute lymphoblastic leukemia is associated with the t(1;19)(q23;p13): a
Pediatric Oncology Group study. Blood 76 : 117–122
10. Cross NC, Melo JV, Feng L, Goldman JM (1994) An optimized multiplex polymerase chain reaction (PCR) for detection
of BCR-ABL fusion mRNAs in haematological disorders.
Leukemia 8 : 186–189
11. Dhut S, Gibbons B, Chaplin T, Young BD (1991) Establishment of a lymphoblastoid cell line, SD-1, expressing the p190
bcr-abl chimaeric protein. Leukemia 5 : 49–55 162
12. Drexler HG, Dirks W, MacLeod RAF, Quentmeier H,
Steube K, Uphoff CC (1997) Human and animal cell lines.
DSMZ Catalogue
13. Fletcher JA, Lynch EA, Kimball VM, Donnelly M, Tantravahi R, Sallan SE (1991) Translocation (9;22) is associated with
extremely poor prognosis in intensively treated children with
acute lymphoblastic leukemia. Blood 77 : 435–439
14. Golub TR, McLean T, Stegmaier K, Carroll M, Tomasson M,
Gilliland DG (1996) The TEL gene and human leukemia.
Biochim Biophys Acta Rev Cancer 1288 : M7–M10
15. Gu Y, Nakamura T, Alder H, Prasad R, Canaani O, Cimino
G, Croce CM, Canaani E (1992) The t(4;11) chromosome
translocation of human acute leukemias fuses the ALL-1
gene, related to Drosophila trithorax, to the AF-4 gene. Cell
71 : 701–708
16. Gu Y, Alder H, Nakamura T, Schichman SA, Prasad R, Canaani O, Saito H, Croce CM, Canaani E (1994) Sequence
analysis of the breakpoint cluster region in the ALL-1 gene
involved in acute leukemia. Cancer Res 54 : 2326–2330
17. Harbott J (1998) Cytogenetics in childhood acute lymphoblastic leukemia. Rev Clin Exp Hematol 5 : 25–43
18. Harbott J, Viehmann S, Borkhardt A, Henze G, Lampert F
(1997) Incidence of TEL/AML1 fusion gene analyzed consecutively in children with acute lymphoblastic leukemia in relapse. Blood 90 : 4933–4937
19. Hawkins JM, Secker WL (1991) Evaluation of cytogenetic
samples and pertinent technical variables in adult acute lymphocytic leukemia. Cancer Genet Cytogenet 52 : 79–84
20. Heisterkamp N, Jenkins R, Thibodeau S, Testa JR, Weinberg
K, Groffen J (1989) The bcr gene in Philadelphia chromosome positive acute lymphoblastic leukemia. Blood
73 : 1307–1311
21. Hilden JM, Chen CS, Moore R, Frestedt J, Kersey JH (1993)
Heterogeneity in MLL/AF-4 fusion messenger RNA detected
by the polymerase chain reaction in t(4;11) acute leukemia.
Cancer Res 53 : 3853–3856
22. Izraeli S, Lion T (1991) Multiprimer-PCR for screening of genetic abnormalities in acute lymphoblastic leukaemia. Br J
Haematol 79 : 645–647
23. Izraeli S, Janssen JW, Haas OA, Harbott J, Brok Simoni F,
Walther JU, Kovar H, Henn T, Ludwig WD, Reiter A, Rechavi G, Bartram CR, Gadner H, Lion T (1993) Detection
and clinical relevance of genetic abnormalities in pediatric
acute lymphoblastic leukemia: a comparison between cytogenetic and polymerase chain reaction analyses. Leukemia
7 : 671–678
24. Kurzrock R, Gutterman JU, Talpaz M (1988) The molecular
genetics of Philadelphia chromosome-positive leukemias. N
Engl J Med 319 : 990–998
25. Liang DC, Chou TB, Chen JS, Shurtleff SA, Rubnitz JE,
Downing JR, Pui CH, Shih LY (1996) High incidence of
TEL/AML1 fusion resulting from a cryptic t(12; 21) in childhood B-lineage acute lymphoblastic leukemia in Taiwan.
Leukemia 10 : 991–993
26. Martinez CJ (1997) Molecular cytogenetics of childhood hematological malignancies. Leukemia 11 : 1999–2021
27. McLean TW, Ringold S, Neuberg D, Stegmaier K, Tantravahi R, Ritz J, Koeffler HP, Takeuchi S, Janssen JWG, Seriu T,
Bartram CR, Sallan SE, Gilliland DG, Golub TR (1996)
TEL/AML-1 dimerizes and is associated with a favorable outcome in childhood acute lymphoblastic leukemia. Blood
88 : 4252–4258
28. Miyoshi H, Ohira M, Shimizu K, Mitani K, Hirai H, Imai T,
Yokoyama K, Soeda E, Ohki M (1995) Alternative splicing
and genomic structure of the AML1 gene involved in acute
myeloid leukemia. Nucleic Acids Res 23 : 2762–2769
29. Pui CH (1995) Childhood leukemias. N Engl J Med
332 : 1618–1630
30. Pui CH, Frankel LS, Carroll AJ, Raimondi SC, Shuster JJ,
Head DR, Crist WM, Land VJ, Pullen DJ, Steuber CP, Behm
FG, Borowitz M (1991) Clinical characteristics and treatment
outcome of childhood acute lymphoblastic leukemia with the 31.
32. 33. 34.
35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. t(4;11)(q21;q23): a collaborative study of 40 cases [see comments]. Blood 77 : 440–447
Raimondi SC (1993) Current status of cy...
Attachments:
-----------